About   Help   FAQ
Mogat1em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
Summary
Symbol: Mogat1em1(IMPC)Hmgu
Name: monoacylglycerol O-acyltransferase 1; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
MGI ID: MGI:6399911
Gene: Mogat1  Location: Chr1:78487628-78514810 bp, + strand  Genetic Position: Chr1, 40.59 cM, cytoband C4
Alliance: Mogat1em1(IMPC)Hmgu page
IMPC: Mogat1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ATCATTATAAGAGGACGAAA, CCAAACAGTCTCCTTAACCC, GTTTGGGAAGGACTAGGCGA, and TGCCTTCTGTATCTGCCGTG that targeted exon(s) ENSMUSE00000361596.5. This resulted in deletion(s) of 1178 bp (location: Chr1:78498578-78499755; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mogat1 Mutation:  22 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory