Gm15551^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm15551^{em1(IMPC)Ccpcz}
• Name: predicted gene 15551; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6399883
• Gene: Gm15551 Location: Chr3:126460978-126462592 bp, - strand Genetic Position: Chr3, 55.99 cM
• Alliance: Gm15551^{em1(IMPC)Ccpcz} page
• IMPC: Gm15551 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTTACAGGGTTTCGCCTCGGTT, TTGCCTTGGGGGAGACGGGCAGG, which resulted in a Exon Deletion. Sanger sequencing verified a 1113 bp deletion including exon 1 of Gm15551 (3:126462197-126463309, GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gm15551 Mutation: 0 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)