Cchcr1em1Aoka
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cchcr1em1Aoka |
| Name: |
coiled-coil alpha-helical rod protein 1; endonuclease-mediated mutation 1, Akira Oka |
| MGI ID: |
MGI:6394064 |
| Synonyms: |
Alopecic Cchcr1, Cchcr1p.Arg587Trp |
| Gene: |
Cchcr1 Location: Chr17:35827997-35841912 bp, + strand Genetic Position: Chr17, 18.69 cM
|
| Alliance: |
Cchcr1em1Aoka page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Specified) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Arginine codon 591 (CGT) was targeted for change to a tryptophan codon (TGG)(p.R591W) with sgRNAs (targeting GCTGTGTCAGCTCCTGACGGAGG and GGAAGCTGCCAGCCTCCGTCAGG) and an ssODN template (CAGCAGTTGGAGGCAGCACGTCGGGGCCAGCAGGAGAGCACGGAGGAAGCTGCCAGCCTCtGgCAGGAGCTGACACAGCAGCAGGAAATCTACGGGCAAGGTGTGGGGGCGTGGCGGTGTGTG) using CRISPR/CAS9 technology. This mutation mimics the human p.R587W variant associated with susceptibility to alopecia areata.
(J:309941)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Cchcr1 Mutation: |
41 strains or lines available
|
|
| Original: |
J:309941 Oka A, et al., Alopecia areata susceptibility variant in MHC region impacts expressions of genes contributing to hair keratinization and is involved in hair loss. EBioMedicine. 2020 Jul;57:102810 |
| All: |
1 reference(s) |
|