About   Help   FAQ
Wdr53em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr53em1(IMPC)J
Name: WD repeat domain 53; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6394015
Gene: Wdr53  Location: Chr16:32066047-32075901 bp, + strand  Genetic Position: Chr16, 22.47 cM
Alliance: Wdr53em1(IMPC)J page
IMPC: Wdr53 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAAAAAGCCCGTCCTGTT and GTATCCCCTAAATGAGCTTT, which resulted in a 559 bp deletion beginning at Chromosome 16 position 32,256,492 bp and ending after 32,257,050 bp (GRCm38/mm10). This mutation deletes 559 bp from ENSMUSE00000130400 (exon 3) and is predicted to cause a change of amino acid sequence after residue 171 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Wdr53 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory