Unklem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Unklem1(IMPC)J |
| Name: |
unkempt family like zinc finger; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6394011 |
| Gene: |
Unkl Location: Chr17:25407371-25453417 bp, + strand Genetic Position: Chr17, 12.53 cM, cytoband A3.3
|
| Alliance: |
Unklem1(IMPC)J page
|
| IMPC: |
Unkl gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAGCAGTTATAGCCCGA and AATGGCTCACGGTTAGCAGT, which resulted in a 299 bp deletion beginning at Chromosome 17 position 25,201,004 bp and ending after 25,201,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001293958 (exon 4) and 165 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 1 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|