Tg(UBC-GFP,-RNAi:Clec16a)KD5Kslr
Transgene Detail

Summary

• Symbol: Tg(UBC-GFP,-RNAi:Clec16a)KD5Kslr
• Name: transgene lentiviral insertion KD5, Stephan Kissler
• MGI ID: MGI:6393885
• Transgene: Tg(UBC-GFP,-RNAi:Clec16a)KD5Kslr Location: unknown
• Alliance: Tg(UBC-GFP,-RNAi:Clec16a)KD5Kslr page

Transgene origin

• Strain of Origin: NOD/MrkTac

Transgene description

• Transgene Type: Transgenic (Knockdown, Reporter)
• Mutation: Insertion
• Tg(UBC-GFP,-RNAi:Clec16a)KD5Kslr involves 1 genes/genome features (Clec16a) View all
• Mutation details: The lentivirus vector introduces a ubiquitously expressed human ubiquitin C promoter driving a short hairpin RNA targeting Clec16a (GAGTGTCCACCTTGTACGTCAT in KD5) inserted into the 3'UTR of GFP. (J:229746)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available

References

• Original: J:229746 Schuster C, et al., The Autoimmunity-Associated Gene CLEC16A Modulates Thymic Epithelial Cell Autophagy and Alters T Cell Selection. Immunity. 2015 May 19;42(5):942-52
• All: 1 reference(s)