About   Help   FAQ
Zbed6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zbed6em1(IMPC)J
Name: zinc finger, BED type containing 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6393538
Gene: Zbed6  Location: Chr1:133547678-133589056 bp, - strand  Genetic Position: Chr1, Syntenic
Alliance: Zbed6em1(IMPC)J page
IMPC: Zbed6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGATTGCCAACTACACA and TCTTCTGCCAGGAGAGATTG, which resulted in a 2700 bp deletion beginning at Chromosome 1 position 133,656,861 bp and ending after 133,659,560 bp (GRCm38/mm10). This mutation deletes 2700 bp from ENSMUSE00001073319 (exon 1) and is predicted to cause a change of amino acid sequence after residue 12, deletion of 901 amino acids and a return to frame for the last 67 amino acids and expected termination. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zbed6 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory