Tigd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tigd3^em1(IMPC)J
• Name: tigger transposable element derived 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6393533
• Gene: Tigd3 Location: Chr19:5941166-5944156 bp, - strand Genetic Position: Chr19, 4.34 cM
• Alliance: Tigd3^em1(IMPC)J page
• IMPC: Tigd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGAAATTCTATGACTGTG and GAAGCTTCACGCCCTGTCCC, which resulted in a 1343 bp deletion beginning at Chromosome 19 position 5,891,723 bp and ending after 5,893,065 bp (GRCm38/mm10). This mutation deletes 1343 bp from ENSMUSE00000395106 (exon 2) and is predicted to cause a change of amino acid sequence and early truncation after residue 12. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tigd3 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)