About   Help   FAQ
Tigd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tigd3em1(IMPC)J
Name: tigger transposable element derived 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6393533
Gene: Tigd3  Location: Chr19:5941166-5944156 bp, - strand  Genetic Position: Chr19, 4.34 cM
Alliance: Tigd3em1(IMPC)J page
IMPC: Tigd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGAAATTCTATGACTGTG and GAAGCTTCACGCCCTGTCCC, which resulted in a 1343 bp deletion beginning at Chromosome 19 position 5,891,723 bp and ending after 5,893,065 bp (GRCm38/mm10). This mutation deletes 1343 bp from ENSMUSE00000395106 (exon 2) and is predicted to cause a change of amino acid sequence and early truncation after residue 12. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tigd3 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory