About   Help   FAQ
Abcd1em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Abcd1em2Lutzy
Name: ATP-binding cassette, sub-family D member 1; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6392813
Synonyms: Abcd1delta897
Gene: Abcd1  Location: ChrX:72760203-72782140 bp, + strand  Genetic Position: ChrX, 37.39 cM, cytoband B
Alliance: Abcd1em2Lutzy page
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsFour oligo nucleotide guides RNAs (ACAAAATCTACCCTCTAGTA, GTCAGACACTGCCGTACTAG, TAAAGTTGTAGATAGACACT and AGACACTGGGACAAGCTTGG) were designed to introduce a large frameshift deletion mutation spanning exon 1/intron 1 of the gene using CRISPR/Cas9 genome editing. DNA sequencing of the offspring identified the allele to be a 897 nt frameshift deletion that begins 103 nt 3' of the ATG translation start codon in exon 1 and extends 100 nt into intron 1. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abcd1 Mutation:  17 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory