About   Help   FAQ
Ensaem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ensaem1(IMPC)J
Name: endosulfine alpha; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6392061
Gene: Ensa  Location: Chr3:95532304-95539413 bp, + strand  Genetic Position: Chr3, 40.74 cM
Alliance: Ensaem1(IMPC)J page
IMPC: Ensa gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACGACACACCAATAAGCGT and AGGCTCATTACATTGGGAGA, which resulted in a 7358 bp deletion beginning at Chromosome 3 position 95,624,895 bp and ending after 95,632,252 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001346731, ENSMUSE00000251943, and ENSMUSE00000492954 (exons 1, 2 and 3) and 3436 bp of flanking intronic sequence including the splice acceptor and donor and start site. This allele is predicted to generate a null allele. There is a 9 bp AGAAAGCAG insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ensa Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory