About   Help   FAQ
Taar8aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Taar8aem1(IMPC)J
Name: trace amine-associated receptor 8A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6390579
Gene: Taar8a  Location: Chr10:23952398-23953432 bp, + strand  Genetic Position: Chr10, 11.42 cM
Alliance: Taar8aem1(IMPC)J page
IMPC: Taar8a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAAAAAGGATTTATAACCG and GTATTTTTCTAGCTTCATAA, which resulted in a 1239 bp deletion beginning at Chromosome 10 position 24,076,376 bp and ending after 24,077,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051733 (exon 1) and 204 bp of flanking intronic sequence including the splice acceptor, donor and start site. This mutation is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Taar8a Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory