About   Help   FAQ
Zfyve26em2(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfyve26em2(IMPC)J
Name: zinc finger, FYVE domain containing 26; endonuclease-mediated mutation 2, Jackson
MGI ID: MGI:6389075
Gene: Zfyve26  Location: Chr12:79279120-79343078 bp, - strand  Genetic Position: Chr12, 35.51 cM
Alliance: Zfyve26em2(IMPC)J page
IMPC: Zfyve26 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at The Jackson Laboratory by injecting D10A RNA and 2 guide sequences CCTTGTCCCCGGTGTAGTTGAGG, CCAGCGCCTGTAGTATGTCCTCC, which resulted in a Indel. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Zfyve26 Mutation:  106 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory