Fancf^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fancf^em1(IMPC)J
• Name: Fanconi anemia, complementation group F; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6388628
• Gene: Fancf Location: Chr7:51510325-51512015 bp, - strand Genetic Position: Chr7, 32.87 cM
• Alliance: Fancf^em1(IMPC)J page
• IMPC: Fancf gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCCACACTCAAGCACCACC and TTGCTGCACAAGCGGCTCCA, which resulted in a 1010 bp deletion beginning at Chromosome 7 position 51,861,249 bp and ending after 51,862,258 bp (GRCm38/mm10). This mutation deletes 1010 bp of ENSMUSE00000879688 (exon 1) including the start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fancf Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)