Ttc1^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttc1^em1(IMPC)Mbp
• Name: tetratricopeptide repeat domain 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6386313
• Synonyms: Ttc1^-
• Gene: Ttc1 Location: Chr11:43620833-43638835 bp, - strand Genetic Position: Chr11, 25.81 cM, cytoband B1.1
• Alliance: Ttc1^em1(IMPC)Mbp page
• IMPC: Ttc1 gene page

Ttc1^em1(IMPC)Mbp/Ttc1^em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form irregular outgrowths with poorly defined inner cell mass colony.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CCACTGCCAGCTTTAAGTTT and CTTTCGGGAAGGTAGCGTAT that targeted exon(s) ENSMUSE00000261882.2. This resulted in deletion(s) of 535 bp (location: Chr11:43632277-43632811; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ttc1 Mutation: 16 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)