About   Help   FAQ
Pcdha9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdha9em1(IMPC)J
Name: protocadherin alpha 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385911
Gene: Pcdha9  Location: Chr18:37130933-37320710 bp, + strand  Genetic Position: Chr18, 19.46 cM
Alliance: Pcdha9em1(IMPC)J page
IMPC: Pcdha9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGTTCGCTGTTTCTCAG and TTAAAAATACTTGTGCATAG, which resulted in a 2665 bp deletion beginning at Chromosome 18 position 36,997,816 bp and ending after 37,000,480 bp (GRCm38/mm10). This mutation deletes 2665 bp from ENSMUSE00000703749 (exon 1) including the splice acceptor, start site and donor and is predicted to a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcdha9 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory