About   Help   FAQ
Gtsf1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gtsf1lem1(IMPC)J
Name: gametocyte specific factor 1-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385644
Gene: Gtsf1l  Location: Chr2:162928954-162929775 bp, - strand  Genetic Position: Chr2, 84.04 cM, cytoband H3
Alliance: Gtsf1lem1(IMPC)J page
IMPC: Gtsf1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTAGTTAGGCCTTCCCTA and AACCCCTTATTCATCAGCGT, which resulted in a 1255 bp deletion beginning at Chromosome 2 position 163,086,776 bp and ending after 163,088,030 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000597815 (exon 1) and 433 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele. There is a 3 bp insertion (TTA) 5 bp after the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gtsf1l Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory