About   Help   FAQ
Dcaf1em1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
Summary
Symbol: Dcaf1em1(IMPC)Ccpcz
Name: DDB1 and CUL4 associated factor 1; endonuclease-mediated mutation 1, Institute of Molecular Genetics
MGI ID: MGI:6385276
Gene: Dcaf1  Location: Chr9:106699073-106758191 bp, + strand  Genetic Position: Chr9, 57.98 cM
Alliance: Dcaf1em1(IMPC)Ccpcz page
IMPC: Dcaf1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCCCTTCACTATTGATTGATCAT, GTTGGGCCTTACAAATAGTTTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dcaf1 Mutation:  70 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory