About   Help   FAQ
Tmem179em2(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem179em2(IMPC)J
Name: transmembrane protein 179; endonuclease-mediated mutation 2, Jackson
MGI ID: MGI:6385163
Gene: Tmem179  Location: Chr12:112466618-112477594 bp, - strand  Genetic Position: Chr12, 61.2 cM
Alliance: Tmem179em2(IMPC)J page
IMPC: Tmem179 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATACGGTGGGGCCATGCCG and TCAACATCGGAACATTTGCA, which resulted in a 1752 bp deletion beginning at Chromosome 12 position 112,503,097 bp and ending after 112,504,848 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435049 and ENSMUSE00000435046 (exons 2 and 3) and 1535 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 18 amino acids later. There is a 3 bp insertion (CTA) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmem179 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory