Tmem179em2(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmem179em2(IMPC)J |
| Name: |
transmembrane protein 179; endonuclease-mediated mutation 2, Jackson |
| MGI ID: |
MGI:6385163 |
| Gene: |
Tmem179 Location: Chr12:112466618-112477594 bp, - strand Genetic Position: Chr12, 61.2 cM
|
| Alliance: |
Tmem179em2(IMPC)J page
|
| IMPC: |
Tmem179 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATACGGTGGGGCCATGCCG and TCAACATCGGAACATTTGCA, which resulted in a 1752 bp deletion beginning at Chromosome 12 position 112,503,097 bp and ending after 112,504,848 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435049 and ENSMUSE00000435046 (exons 2 and 3) and 1535 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 18 amino acids later. There is a 3 bp insertion (CTA) at the deletion site.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|