About   Help   FAQ
Lilrb4bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lilrb4bem1(IMPC)J
Name: leukocyte immunoglobulin-like receptor, subfamily B, member 4B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385151
Gene: Lilrb4b  Location: Chr10:51356757-51362417 bp, + strand  Genetic Position: Chr10, 25.5 cM
Alliance: Lilrb4bem1(IMPC)J page
IMPC: Lilrb4b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCTGTGATTATCTGGTGT and TTTATGACAGCCTCATATGC, which resulted in a 137 bp deletion beginning at Chromosome 10 position 51,481,213 bp and ending after 51,481,349 bp (GRCm38/mm10). This mutation deletes 137 bp from ENSMUSE00001008219 (exon 3) and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lilrb4b Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory