Trim69em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Trim69em1(IMPC)J |
| Name: |
tripartite motif-containing 69; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6385121 |
| Gene: |
Trim69 Location: Chr2:121991189-122009503 bp, + strand Genetic Position: Chr2, 60.55 cM
|
| Alliance: |
Trim69em1(IMPC)J page
|
| IMPC: |
Trim69 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGTGTGAAATTCCCCA and TTAGTTCTGTAGTTTGAGAG, which resulted in a 1495 bp deletion beginning at Chromosome 2 position 122,173,063 bp and ending after 122,174,557 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001284708, ENSMUSE00001259295 and ENSMUSE00001310986 (exons 4,5,6) and 1113 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 194 and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|