About   Help   FAQ
Trim69em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trim69em1(IMPC)J
Name: tripartite motif-containing 69; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385121
Gene: Trim69  Location: Chr2:121991189-122009503 bp, + strand  Genetic Position: Chr2, 60.55 cM
Alliance: Trim69em1(IMPC)J page
IMPC: Trim69 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGTGTGAAATTCCCCA and TTAGTTCTGTAGTTTGAGAG, which resulted in a 1495 bp deletion beginning at Chromosome 2 position 122,173,063 bp and ending after 122,174,557 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001284708, ENSMUSE00001259295 and ENSMUSE00001310986 (exons 4,5,6) and 1113 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 194 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Trim69 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory