Slc17a1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc17a1em1(IMPC)J |
| Name: |
solute carrier family 17 (sodium phosphate), member 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6384875 |
| Gene: |
Slc17a1 Location: Chr13:24051733-24079713 bp, + strand Genetic Position: Chr13, 9.97 cM, cytoband A3-A4
|
| Alliance: |
Slc17a1em1(IMPC)J page
|
| IMPC: |
Slc17a1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAAGGGACTTACTTCCAAA and TCGTGAGCTAGGTTCTACAG, which resulted in a 522 bp deletion beginning at Chromosome 13 position 23,874,305 bp and ending after 23,874,826 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000253347 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 8 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|