About   Help   FAQ
Isy1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Isy1em1(IMPC)J
Name: ISY1 splicing factor homolog; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6384859
Synonyms: Isy1-
Gene: Isy1  Location: Chr6:87795429-87815723 bp, - strand  Genetic Position: Chr6, 39.13 cM, cytoband D2
Alliance: Isy1em1(IMPC)J page
IMPC: Isy1 gene page
Isy1em1(IMPC)J/Isy1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 that appear as dying morulae but no embryos at E7.5. Embryos fail to hatch from the zona pellucida and to form outgrowths in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGAGGCATTCAAAGCCTGG and TGTATTGTGAACAAAAGAGC, which resulted in a 431 bp deletion beginning at Chromosome 6 position 87,825,195 bp and ending after 87,825,625 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323874 (exon 7) and 313 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Isy1 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory