Isy1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Isy1em1(IMPC)J |
| Name: |
spliceosome associated protein; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6384859 |
| Synonyms: |
Isy1- |
| Gene: |
Isy1 Location: Chr6:87795429-87815723 bp, - strand Genetic Position: Chr6, 39.13 cM, cytoband D2
|
| Alliance: |
Isy1em1(IMPC)J page
|
| IMPC: |
Isy1 gene page |
|
Isy1em1(IMPC)J/Isy1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 that appear as dying morulae but no embryos at E7.5. Embryos fail to hatch from the zona pellucida and to form outgrowths in vitro.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ATGAGGCATTCAAAGCCTGG and TGTATTGTGAACAAAAGAGC that targeted exon(s) ENSMUSE00000323874.4 ENSMUSE00001365059.2. This resulted in deletion(s) of 431 bp (location: Chr6:87802177-87802607; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|