Slc10a3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc10a3^em1(IMPC)J
• Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6383678
• Gene: Slc10a3 Location: ChrX:73412823-73416955 bp, - strand Genetic Position: ChrX, 38.0 cM
• Alliance: Slc10a3^em1(IMPC)J page
• IMPC: Slc10a3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTTCACTCCTTATAGTGCAG and GATGGCTGAATGACATTCAA that targeted exon(s) ENSMUSE00000655036.3 ENSMUSE00000698281.2 ENSMUSE00000698284.2 ENSMUSE00000993023.2. This resulted in deletion(s) of 2136 bp (location: ChrX:73412592-73414727; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc10a3 Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)