Cstadem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cstadem1(IMPC)J |
| Name: |
CSA-conditional, T cell activation-dependent protein; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6383182 |
| Gene: |
Cstad Location: Chr2:30485056-30498957 bp, + strand Genetic Position: Chr2, 21.71 cM, cytoband B
|
| Alliance: |
Cstadem1(IMPC)J page
|
| IMPC: |
Cstad gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCAGCTGAGCCATAACGG and TCATGAGTTGGTACAGCCAG, which resulted in a 228 bp deletion beginning at Chromosome 2 position 30,608,209 bp and ending after 30,608,436 bp (GRCm38/mm10). This mutation deletes 228 bp from ENSMUSE00000662814 (exon 2) and is predicted to cause a change of amino acid sequence after residue 17 deletes 76 amino acids and remains in frame for the last 11 amino acids before the stop colon.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|