Zbtb34^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb34^em1(IMPC)J
• Name: zinc finger and BTB domain containing 34; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6382793
• Gene: Zbtb34 Location: Chr2:33296120-33321336 bp, - strand Genetic Position: Chr2, 22.44 cM
• Alliance: Zbtb34^em1(IMPC)J page
• IMPC: Zbtb34 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCACTAGATTCCCGCC and ACGTTTCGTGTCGGGAGAAA, which resulted in a 1469 bp deletion beginning at Chromosome 2 position 33,411,009 bp and ending after 33,412,477 bp (GRCm38/mm10) plus the insertion at the deletion site of a 61 bp sequence from ENSMUSE00000694537 (exon 3) in inverse orientation (GGGAATCTAGTGCCATCTCTGAGGCTGATGCATCACTTTCGAGTTTCTGTTCCACATACAT). This is predicted to cause a change of amino acid sequence after residue 17 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zbtb34 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)