About   Help   FAQ
Zbtb34em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zbtb34em1(IMPC)J
Name: zinc finger and BTB domain containing 34; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6382793
Gene: Zbtb34  Location: Chr2:33296120-33321336 bp, - strand  Genetic Position: Chr2, 22.44 cM
Alliance: Zbtb34em1(IMPC)J page
IMPC: Zbtb34 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCACTAGATTCCCGCC and ACGTTTCGTGTCGGGAGAAA, which resulted in a 1469 bp deletion beginning at Chromosome 2 position 33,411,009 bp and ending after 33,412,477 bp (GRCm38/mm10) plus the insertion at the deletion site of a 61 bp sequence from ENSMUSE00000694537 (exon 3) in inverse orientation (GGGAATCTAGTGCCATCTCTGAGGCTGATGCATCACTTTCGAGTTTCTGTTCCACATACAT). This is predicted to cause a change of amino acid sequence after residue 17 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zbtb34 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory