Gtf2h3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gtf2h3em1(IMPC)J |
| Name: |
general transcription factor IIH, polypeptide 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6382787 |
| Gene: |
Gtf2h3 Location: Chr5:124717211-124735743 bp, + strand Genetic Position: Chr5, 63.67 cM
|
| Alliance: |
Gtf2h3em1(IMPC)J page
|
| IMPC: |
Gtf2h3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCATGGCAAAGAAGCTGAG and ATACACCAATTCCCACCACA, which resulted in a 695 bp deletion beginning at Chromosome 5 position 124,583,657 bp and ending after 124,584,351 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266779 and ENSMUSE00001246016 (exons 3 and 4) and 421 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 25 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|