Tubgcp2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tubgcp2em1(IMPC)Tcp |
| Name: |
tubulin, gamma complex component 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:6381351 |
| Synonyms: |
Tubgcp2- |
| Gene: |
Tubgcp2 Location: Chr7:139575868-139616582 bp, - strand Genetic Position: Chr7, 84.98 cM, cytoband F5
|
| Alliance: |
Tubgcp2em1(IMPC)Tcp page
|
| IMPC: |
Tubgcp2 gene page |
|
Tubgcp2em1(IMPC)Tcp/Tubgcp2em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths with little/no inner cell mass colony after 3 days in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR1456 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TTAGGCCCAGATGTTGTAAT targeting the 5' side and CAGTGTGTCACGGCCTGCTG targeting the 3' side of a critical region. This resulted in a 373-bp del Chr7:140029784 to 140030156 (GRCm38).
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|