Lysmd4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lysmd4em1(IMPC)J |
| Name: |
LysM, putative peptidoglycan-binding, domain containing 4; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6380682 |
| Gene: |
Lysmd4 Location: Chr7:66872292-66878216 bp, + strand Genetic Position: Chr7, 36.71 cM
|
| Alliance: |
Lysmd4em1(IMPC)J page
|
| IMPC: |
Lysmd4 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATTCTGTGTCAGTATCAGG and ACAGCATTAGAGTAGCTGAC, which resulted in a 5123 bp deletion beginning at Chromosome 7 position 67,223,456 bp and ending after 67,228,578 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000466123 and ENSMUSE00001380362 (exons 2 and 3) and 2247 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted generate a null allele.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|