Lysmd4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lysmd4^em1(IMPC)J
• Name: LysM, putative peptidoglycan-binding, domain containing 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6380682
• Gene: Lysmd4 Location: Chr7:66872292-66878216 bp, + strand Genetic Position: Chr7, 36.71 cM
• Alliance: Lysmd4^em1(IMPC)J page
• IMPC: Lysmd4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACAGCATTAGAGTAGCTGAC and TATTCTGTGTCAGTATCAGG that targeted exon(s) ENSMUSE00000466123.3 ENSMUSE00001376514.2 ENSMUSE00001377828.2 ENSMUSE00001377998.2 ENSMUSE00001378435.2 ENSMUSE00001379169.2 ENSMUSE00001380362.2 ENSMUSE00001380501.2. This resulted in deletion(s) of 5123 bp (location: Chr7:66873204-66878326; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lysmd4 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)