Cped1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cped1em1(IMPC)J |
| Name: |
cadherin-like and PC-esterase domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6379302 |
| Gene: |
Cped1 Location: Chr6:21985915-22256403 bp, + strand Genetic Position: Chr6, 8.86 cM
|
| Alliance: |
Cped1em1(IMPC)J page
|
| IMPC: |
Cped1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAATCATCACACTCTTTAC and TTGGAACCACTGTATCTGTG, which resulted in a 260 bp deletion beginning at Chromosome 6 position 22,051,254 bp and ending after 22,051,513 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001312394 (exon 3) and 153 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 17 amino acids later. There is a 2 bp TT insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|