Sarm1^em1Agsa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sarm1^em1Agsa
• Name: sterile alpha and HEAT/Armadillo motif containing 1; endonuclease-mediated mutation 1, Adolfo Garcia-Sastre
• MGI ID: MGI:6378547
• Synonyms: Sarm1^AGS3
• Gene: Sarm1 Location: Chr11:78363156-78388580 bp, - strand Genetic Position: Chr11, 46.74 cM
• Alliance: Sarm1^em1Agsa page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Plasmids encoding a signal guide RNA (TCGCGAAGTGTCGCCCGGAGTGG) were designed to introduce a 62 bp deletion in exon 1. This mutation results in a frameshift and a 38 amino acid product. No potential off-target sites are present. (J:300476)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sarm1 Mutation: 27 strains or lines available

References

• Original: J:300476 Uccellini MB, et al., Passenger Mutations Confound Phenotypes of SARM1-Deficient Mice. Cell Rep. 2020 Apr 7;31(1):107498
• All: 5 reference(s)