About   Help   FAQ
Sarm1em1Agsa
Endonuclease-mediated Allele Detail
Summary
Symbol: Sarm1em1Agsa
Name: sterile alpha and HEAT/Armadillo motif containing 1; endonuclease-mediated mutation 1, Adolfo Garcia-Sastre
MGI ID: MGI:6378547
Synonyms: Sarm1AGS3
Gene: Sarm1  Location: Chr11:78363156-78388580 bp, - strand  Genetic Position: Chr11, 46.74 cM
Alliance: Sarm1em1Agsa page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsPlasmids encoding a signal guide RNA (TCGCGAAGTGTCGCCCGGAGTGG) were designed to introduce a 62 bp deletion in exon 1. This mutation results in a frameshift and a 38 amino acid product. No potential off-target sites are present. (J:300476)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sarm1 Mutation:  27 strains or lines available
References
Original:  J:300476 Uccellini MB, et al., Passenger Mutations Confound Phenotypes of SARM1-Deficient Mice. Cell Rep. 2020 Apr 7;31(1):107498
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory