Eva1aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Eva1aem1(IMPC)J |
| Name: |
eva-1 homolog A, regulator of programmed cell death; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6377661 |
| Gene: |
Eva1a Location: Chr6:82018058-82070079 bp, + strand Genetic Position: Chr6, 35.81 cM
|
| Alliance: |
Eva1aem1(IMPC)J page
|
| IMPC: |
Eva1a gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTCTCTATGTAAGGTCA and GTATGACCTCTGCAGGACTC, which resulted in a 1441 bp deletion beginning at Chromosome 6 position 82,091,741 bp and ending after 82,093,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366139 (exon 3) and 135 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 3 amino acids later. There is a 1 bp (A) insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|