Tsen54em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tsen54em1(IMPC)J |
| Name: |
tRNA splicing endonuclease subunit 54; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6377433 |
| Synonyms: |
Tsen54- |
| Gene: |
Tsen54 Location: Chr11:115705550-115713920 bp, + strand Genetic Position: Chr11, 80.91 cM, cytoband E2
|
| Alliance: |
Tsen54em1(IMPC)J page
|
| IMPC: |
Tsen54 gene page |
|
Tsen54em1(IMPC)J/Tsen54em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 72 hr in vitro outgrowth culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAAATCCCATCTACGGTGG and GAAAGTGGATGCTTAGACGA, which resulted in a 1008 bp deletion beginning at Chromosome 11 position 115,820,077 bp and ending after 115,821,084 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304729 and ENSMUSE00000109206 (exons 7 and 8) and 280 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 15 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|