Tsen54^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsen54^em1(IMPC)J
• Name: tRNA splicing endonuclease subunit 54; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6377433
• Synonyms: Tsen54^-
• Gene: Tsen54 Location: Chr11:115705550-115713920 bp, + strand Genetic Position: Chr11, 80.91 cM, cytoband E2
• Alliance: Tsen54^em1(IMPC)J page
• IMPC: Tsen54 gene page

Tsen54^em1(IMPC)J/Tsen54^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 72 hr in vitro outgrowth culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CCAAATCCCATCTACGGTGG and GAAAGTGGATGCTTAGACGA that targeted exon(s) ENSMUSE00000109206.2 ENSMUSE00001304729.2. This resulted in deletion(s) of 1008 bp (location: Chr11:115710903-115711910; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tsen54 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)