Dhx8^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx8^em1(IMPC)Mbp
• Name: DEAH-box helicase 8; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6377202
• Synonyms: Dhx8^-
• Gene: Dhx8 Location: Chr11:101623782-101658184 bp, + strand Genetic Position: Chr11, 65.48 cM
• Alliance: Dhx8^em1(IMPC)Mbp page
• IMPC: Dhx8 gene page

Dhx8^em1(IMPC)Mbp/Dhx8^em1(IMPC)Mbp mice exhibit embryonic lethality, with some embryos recovered at E3.5 as blastocysts but no embryos detected at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths with poorly defined inner cell mass.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AACTGGACCACAATCCCCAC and TCCACTGCGACACAGACTAT that targeted exon(s) ENSMUSE00000421971.2. This resulted in deletion(s) of 641 bp (location: Chr11:101628189-101628829; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dhx8 Mutation: 54 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)