About   Help   FAQ
Ube2q2lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ube2q2lem1(IMPC)J
Name: ubiquitin conjugating enzyme E2 Q2 like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6376261
Gene: Ube2q2l  Location: Chr6:136377315-136392567 bp, - strand  Genetic Position: Chr6, 66.59 cM
Alliance: Ube2q2lem1(IMPC)J page
IMPC: Ube2q2l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACACCATAGCAACTGCACAA and GATGGATTCTCCATGCTAAA, which resulted in a 1677 bp deletion beginning at Chromosome 6 position 136,400,277 bp and ending after 136,401,953 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001369384 (exon 2) and 107 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ube2q2l Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory