About   Help   FAQ
Slc25a44em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc25a44em1(IMPC)J
Name: solute carrier family 25, member 44; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6376222
Gene: Slc25a44  Location: Chr3:88317805-88332446 bp, - strand  Genetic Position: Chr3, 38.82 cM
Alliance: Slc25a44em1(IMPC)J page
IMPC: Slc25a44 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTTACCACAAAGTCG AND GGTGAGGAATGATTTCAGAA, which resulted in a 1060 bp deletion beginning at Chromosome 3 position 88,420,282 bp and ending after 88,421,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980176 (exon 2) and 422 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 43 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc25a44 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory