Kcnj11^em1Mean
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnj11^em1Mean
• Name: potassium inwardly rectifying channel, subfamily J, member 11; endonuclease-mediated mutation 1, Marc E Anderson
• MGI ID: MGI:6376106
• Synonyms: Kir6.2 T224A
• Gene: Kcnj11 Location: Chr7:45746545-45750215 bp, - strand Genetic Position: Chr7, 29.66 cM
• Alliance: Kcnj11^em1Mean page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR-targeting using guide #8 (AACTTCGCCCTCGGGGCTGG) altered the sequence of threonine 224 (CACC) to code for an alanine (TGCT). (J:279869)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcnj11 Mutation: 33 strains or lines available

References

• Original: J:279869 Wu Y, et al., Myocardial death and dysfunction after ischemia-reperfusion injury require CaMKIIdelta oxidation. Sci Rep. 2019 Jun 26;9(1):9291
• All: 1 reference(s)