Osbp^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Osbp^em1(IMPC)Tcp
• Name: oxysterol binding protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6369352
• Synonyms: Osbp^-
• Gene: Osbp Location: Chr19:11943305-11971476 bp, + strand Genetic Position: Chr19, 8.58 cM
• Alliance: Osbp^em1(IMPC)Tcp page
• IMPC: Osbp gene page

Osbp^em1(IMPC)Tcp/Osbp^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida but form irregular outgrowths with no inner cell mass colony or trophoblast giant cells after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CCCACGAAGTCACCTTATTC and CTGAAGACGTTTTCCGCGAT that targeted exon(s) ENSMUSE00000329104.3. This resulted in deletion(s) of 340 bp (location: Chr19:11955100-11955439; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Osbp Mutation: 27 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)