Efcc1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Efcc1^em1(IMPC)Tcp
• Name: EF hand and coiled-coil domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6367978
• Gene: Efcc1 Location: Chr6:87707851-87732890 bp, + strand Genetic Position: Chr6, 39.02 cM, cytoband D2
• Alliance: Efcc1^em1(IMPC)Tcp page
• IMPC: Efcc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at The Centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTTTCACTTGTTACTCGCGGAT, GAATTAGGAGCAGCGTACACTGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Efcc1 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)