Cacnb3^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cacnb3^em1(IMPC)H
• Name: calcium channel, voltage-dependent, beta 3 subunit; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6367944
• Gene: Cacnb3 Location: Chr15:98528721-98542410 bp, + strand Genetic Position: Chr15, 54.64 cM
• Alliance: Cacnb3^em1(IMPC)H page
• IMPC: Cacnb3 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AAGGGACTCCCAAGCCCCCC, GAGAGCCTGTTACCTCCCCA, TCACTCAGGACCCGATTCCA, and TGGAATCGGGTCCTGAGTGA that targeted exon(s) ENSMUSE00000270216.6 ENSMUSE00000484669.3. This resulted in deletion(s) of 841 bp (location: Chr15:98537948-98538788; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Cacnb3 Mutation: 26 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)