About   Help   FAQ
Tpx2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tpx2em1(IMPC)J
Name: TPX2, microtubule-associated; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6367835
Gene: Tpx2  Location: Chr2:152689884-152737241 bp, + strand  Genetic Position: Chr2, 75.41 cM, cytoband H2
Alliance: Tpx2em1(IMPC)J page
IMPC: Tpx2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTCTGCAGTAGTCTGACT and GTTTATGGATTGTAGCTTGC, which resulted in a 253 bp deletion beginning at Chromosome 2 position 152,873,064 bp and ending after 152,873,316 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204719 (exon 5) and 126 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 24 amino acids later. There is a 3 bp insertion (AGA) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tpx2 Mutation:  110 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory