Sptbem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sptbem1(IMPC)J |
| Name: |
spectrin beta, erythrocytic; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6367831 |
| Synonyms: |
Sptb- |
| Gene: |
Sptb Location: Chr12:76627262-76757321 bp, - strand Genetic Position: Chr12, 33.73 cM
|
| Alliance: |
Sptbem1(IMPC)J page
|
| IMPC: |
Sptb gene page |
|
Sptbem1(IMPC)J/Sptbem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and are dead after 72hr in vitro, never forming outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATTGGGATACAGGAAGAG and CCCACCACACTTCAGAAATG, which resulted in a 1369 bp deletion beginning at Chromosome 12 position 76,620,406 bp and ending after 76,621,774 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000114246 (exon 14) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 599 and early truncation 7 amino acids later. There is a 2 bp insertion (AC) at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|