Cct7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cct7^em1(IMPC)J
• Name: chaperonin containing TCP1 subunit 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6367820
• Synonyms: Cct7^-
• Gene: Cct7 Location: Chr6:85428496-85445457 bp, + strand Genetic Position: Chr6, 37.46 cM, cytoband D1
• Alliance: Cct7^em1(IMPC)J page
• IMPC: Cct7 gene page

Cct7^em1(IMPC)J/Cct7^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GTGCCTGAGAGTTTCCCAAG and TTTGATGTAAAACATGAAAG that targeted exon(s) ENSMUSE00000194312.2. This resulted in deletion(s) of 332 bp (location: Chr6:85438358-85438689; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cct7 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)