About   Help   FAQ
Klhl34em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Klhl34em1(IMPC)J
Name: kelch-like 34; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6367818
Gene: Klhl34  Location: ChrX:156601431-156603365 bp, + strand  Genetic Position: ChrX, 72.76 cM
Alliance: Klhl34em1(IMPC)J page
IMPC: Klhl34 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGAGGCATCCCATAACA and TAAGGAGGTGAACAAGGCCT, which resulted in a 1657 bp deletion beginning at Chromosome X position 157,818,351 bp and ending after 157,820,007 bp (GRCm38/mm10). This mutation deletes 1572 bp of ENSMUSE00000543784 (exon 1) and 83 bp upstream of the ATG start and is predicted to generate a null allele. There is a 6 bp insertion TCCAGC at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Klhl34 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory