Smarce1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smarce1^em1(IMPC)J
• Name: SWI/SNF related BAF chromatin remodeling complex subunit E1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6363556
• Synonyms: Smarce1^-
• Gene: Smarce1 Location: Chr11:99099873-99121843 bp, - strand Genetic Position: Chr11, 62.92 cM, cytoband D
• Alliance: Smarce1^em1(IMPC)J page
• IMPC: Smarce1 gene page

Smarce1^em1(IMPC)J/Smarce1^em1(IMPC)J mice exhibit embryonic lethality, with fewer than the expected number of embryos at E3.5 and E7.5, and none at E9.5. Embryos at E3.5 appear as blastocysts which hatch from the zona pellucida and form outgrowths in culture. The scarce E7.5 embryos that are recovered appear as Reichert's membrane only.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences TGGAAAAAATACTCCTTACA and TTTGAAACTGATTAAGCTAA that targeted exon(s) ENSMUSE00001261138.2 ENSMUSE00001305116.2. This resulted in deletion(s) of 955 bp (location: Chr11:99109865-99110819; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smarce1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)