About   Help   FAQ
Smarce1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Smarce1em1(IMPC)J
Name: SWI/SNF related BAF chromatin remodeling complex subunit E1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6363556
Synonyms: Smarce1-
Gene: Smarce1  Location: Chr11:99099873-99121843 bp, - strand  Genetic Position: Chr11, 62.92 cM, cytoband D
Alliance: Smarce1em1(IMPC)J page
IMPC: Smarce1 gene page
Smarce1em1(IMPC)J/Smarce1em1(IMPC)J mice exhibit embryonic lethality, with fewer than the expected number of embryos at E3.5 and E7.5, and none at E9.5. Embryos at E3.5 appear as blastocysts which hatch from the zona pellucida and form outgrowths in culture. The scarce E7.5 embryos that are recovered appear as Reichert's membrane only.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAAAAATACTCCTTACA and TTTGAAACTGATTAAGCTAA, which resulted in a 955 bp deletion beginning at Chromosome 11 position 99,219,039 bp and ending after 99,219,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261138, ENSMUSE00001305116 (exons 6 and 7) and 651 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Smarce1 Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory