Smarce1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Smarce1em1(IMPC)J |
| Name: |
SWI/SNF related BAF chromatin remodeling complex subunit E1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6363556 |
| Synonyms: |
Smarce1- |
| Gene: |
Smarce1 Location: Chr11:99099873-99121843 bp, - strand Genetic Position: Chr11, 62.92 cM, cytoband D
|
| Alliance: |
Smarce1em1(IMPC)J page
|
| IMPC: |
Smarce1 gene page |
|
Smarce1em1(IMPC)J/Smarce1em1(IMPC)J mice exhibit embryonic lethality, with fewer than the expected number of embryos at E3.5 and E7.5, and none at E9.5. Embryos at E3.5 appear as blastocysts which hatch from the zona pellucida and form outgrowths in culture. The scarce E7.5 embryos that are recovered appear as Reichert's membrane only.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAAAAATACTCCTTACA and TTTGAAACTGATTAAGCTAA, which resulted in a 955 bp deletion beginning at Chromosome 11 position 99,219,039 bp and ending after 99,219,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261138, ENSMUSE00001305116 (exons 6 and 7) and 651 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 7 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|