Rr250^em1Ebres
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr250^em1Ebres
• Name: regulatory region 250; endonuclease-mediated mutation 1, Emery H Bresnick
• MGI ID: MGI:6363029
• Synonyms: Samd14^em1Ebres, Samd14-Enh^-
• Gene: Rr250 Location: unknown Genetic Position: Chr11, Syntenic
• Alliance: Rr250^em1Ebres page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph, Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: TALEN-targeting of exon 1 deleted 33 bp (GGCTCATCTGTCAGGGAGAGATAAAACCCACAT) within the Gata2 +9.5 enhancer-like (E-box and GATA motifs) Samd14 enhancer in intron 1. Mass spectrometry for three peptides confirmed a 16-fold reduction in protein expression. (J:270526)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr250 Mutation: 0 strains or lines available

References

• Original: J:270526 Hewitt KJ, et al., GATA Factor-Regulated Samd14 Enhancer Confers Red Blood Cell Regeneration and Survival in Severe Anemia. Dev Cell. 2017 Aug 7;42(3):213-225.e4
• All: 3 reference(s)