Atp6v1f^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6v1f^em1(IMPC)J
• Name: ATPase, H+ transporting, lysosomal V1 subunit F; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6362956
• Synonyms: Atp6v1f^-
• Gene: Atp6v1f Location: Chr6:29467782-29470508 bp, + strand Genetic Position: Chr6, 12.36 cM, cytoband A3
• Alliance: Atp6v1f^em1(IMPC)J page
• IMPC: Atp6v1f gene page

Atp6v1f^em1(IMPC)J/Atp6v1f^em1(IMPC)J embryos exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACTTTCATGCAGACACAGAG and GCTGGGAGGGGCCTGCCCAA that targeted exon(s) ENSMUSE00001261029.2 ENSMUSE00001983874.1 ENSMUSE00001983876.1 ENSMUSE00001983877.1 ENSMUSE00002108194.1 ENSMUSE00002143435.1 ENSMUSE00002170966.1 ENSMUSE00002170967.1 ENSMUSE00002186822.1. This resulted in deletion(s) of 382 bp (location: Chr6:29469355-29469736; GRCm39), 899 bp (location: Chr6:29469830-29470728; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atp6v1f Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)