About   Help   FAQ
Atp6v1fem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp6v1fem1(IMPC)J
Name: ATPase, H+ transporting, lysosomal V1 subunit F; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6362956
Synonyms: Atp6v1f-
Gene: Atp6v1f  Location: Chr6:29467782-29470508 bp, + strand  Genetic Position: Chr6, 12.36 cM, cytoband A3
Alliance: Atp6v1fem1(IMPC)J page
IMPC: Atp6v1f gene page
Atp6v1fem1(IMPC)J/Atp6v1fem1(IMPC)J embryos exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTTCATGCAGACACAGAG and GCTGGGAGGGGCCTGCCCAA, which resulted in a 899 bp deletion beginning at Chromosome 6 position 29,469,831 bp and ending after 29,470,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261029 (exon 2) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Atp6v1f Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory