Zfp518b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp518b^em1(IMPC)J
• Name: zinc finger protein 518B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6362954
• Gene: Zfp518b Location: Chr5:38825828-38842120 bp, - strand Genetic Position: Chr5, 20.77 cM
• Alliance: Zfp518b^em1(IMPC)J page
• IMPC: Zfp518b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCGGACATTAAATGGGG and CATGAACTTGAGCTACCTGG, which resulted in a 6658 bp deletion beginning at Chromosome 5 position 38,668,433 bp and ending after 38,675,090 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001363757 (exon 4) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele. There is a 6 bp insertion at the deletion site (CATGTG). (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zfp518b Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)