About   Help   FAQ
Zfp518bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp518bem1(IMPC)J
Name: zinc finger protein 518B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6362954
Gene: Zfp518b  Location: Chr5:38825828-38842120 bp, - strand  Genetic Position: Chr5, 20.77 cM
Alliance: Zfp518bem1(IMPC)J page
IMPC: Zfp518b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCGGACATTAAATGGGG and CATGAACTTGAGCTACCTGG, which resulted in a 6658 bp deletion beginning at Chromosome 5 position 38,668,433 bp and ending after 38,675,090 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001363757 (exon 4) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele. There is a 6 bp insertion at the deletion site (CATGTG). (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Zfp518b Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory