About   Help   FAQ
Gtpbp4em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gtpbp4em1(IMPC)Tcp
Name: GTP binding protein 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6362818
Synonyms: Gtpbp4-
Gene: Gtpbp4  Location: Chr13:9016367-9046119 bp, - strand  Genetic Position: Chr13, 3.64 cM, cytoband A1
Alliance: Gtpbp4em1(IMPC)Tcp page
IMPC: Gtpbp4 gene page
Gtpbp4em1(IMPC)Tcp/Gtpbp4em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1412 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAAGGGAGCTGCTTCTCCGG targeting the 5' side and GGGTTCTCATGATAGCTTAG targeting the 3' side of a critical region. This resulted in a 834-bp del Chr13: 8991436-8992269 with an insertion of 17-bp, TATCATGAGGGGTTCTC, at the repair junction (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gtpbp4 Mutation:  35 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory