About   Help   FAQ
1700030J22Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 1700030J22Rikem1(IMPC)J
Name: RIKEN cDNA 1700030J22 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6362055
Gene: 1700030J22Rik  Location: Chr8:117696333-117705698 bp, - strand  Genetic Position: Chr8, 63.41 cM, cytoband E1
Alliance: 1700030J22Rikem1(IMPC)J page
IMPC: 1700030J22Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, ACTTTGCTTTCTAGCACGTG and GTGAGGTCCTTCCCCAGCCA, which resulted in a 926 bp deletion beginning at Chromosome 8 position 116,971,225 bp and ending after 116,972,150 bp (GRCm38/mm10). This mutation deletes 926 bp of ENSMUSE00000425915 (exon 3) and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 6 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 1700030J22Rik Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory