Camsap1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Camsap1^em1(IMPC)J
• Name: calmodulin regulated spectrin-associated protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361950
• Gene: Camsap1 Location: Chr2:25816850-25873294 bp, - strand Genetic Position: Chr2, 18.29 cM
• Alliance: Camsap1^em1(IMPC)J page
• IMPC: Camsap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCATCTGACCCTAATGGAA and ATGCCATCGGATTAAAGAAG, which resulted in an 826 bp deletion beginning at Chromosome 2 position 25,966,411 bp and ending after 25,967,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264038 (exon 2) and 563 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 21 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Camsap1 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)